.fastq
FASTQ format is a text-based format for storing both a biological sequence (usually nucleotide sequence) and its corresponding quality scores. Both the sequence letter and quality score are encoded with a single ASCII character for brevity. It was originally developed at the Wellcome Trust Sanger Institute to bundle a FASTA sequence and its quality data, but has recently become the de facto standard for storing the output of high throughput sequencing instruments such as the Illumina (company)|Illumina Genome Analyzer. The Sanger FASTQ file format for sequences with quality scores, and the Solexa/Illumina FASTQ variants.
Format
A FASTQ file normally uses four lines per sequence. Line 1 begins with a '@' character and is followed by a sequence identifier and an optional description (like a FASTA title line). Line 2 is the raw sequence letters. Line 3 begins with a '+' character and is optionally followed by the same sequence identifier (and any description) again. Line 4 encodes the quality values for the sequence in Line 2, and must contain the same number of symbols as letters in the sequence.
A minimal FASTQ file might look like this:
@SEQ_ID GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT + !''*((((***+))%%%++)(%%%%).1***-+*''))**55CCF>>>>>>CCCCCCC65
The original Sanger FASTQ files also allowed the sequence and quality strings to be wrapped (split over multiple lines), but this is generally discouraged as it can make parsing complicated due to the unfortunate choice of "@" and "+" as markers (these characters can also occur in the quality string).
Different quality score scales
The standard format is the Sanger Phred scale.
Old Illumina pipelines output the formats in a slightly different scale: convert your datasets to the same scale with the Galaxy tool 'Groomer'. See Galaxy beginner's tutorial.
See:
- https://github.com/biopython/biopython/blob/master/Bio/SeqIO/QualityIO.py
- http://clcbio.com/manual/genomics/Quality_scores_in_Illumina_platform.html
Format validation
- FastQValidator - checks whether your fastq is formatted well.
- Galaxy's Groomer - the webinterface of Galaxy contains a tool Groomer that checks your fastq format.
